Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCAGTCGGTTCAGAAGTTCTCATTC[C/T]TGTCTACGGATGCCATTCCTTTCTT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 102776 | ||||||||||||||||||||
Literature Links: |
ADORA2A PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ADORA2A - adenosine A2a receptor | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000675.5 | Intron | NP_000666.2 | ||||
NM_001278497.1 | Intron | NP_001265426.1 | ||||
NM_001278498.1 | Intron | NP_001265427.1 | ||||
NM_001278499.1 | Intron | NP_001265428.1 | ||||
NM_001278500.1 | Intron | NP_001265429.1 |
ADORA2A-AS1 - ADORA2A antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SPECC1L-ADORA2A - SPECC1L-ADORA2A readthrough (NMD candidate) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |