Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GACCTTAAGCATGTCAAAGACATGA[C/T]AGGAAGATTGTTCCAGGATGACACT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 609080 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
FAM185A PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
FAM185A - family with sequence similarity 185 member A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FBXL13 - F-box and leucine rich repeat protein 13 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001111038.1 | Intron | NP_001104508.1 | ||||
NM_001287150.1 | Intron | NP_001274079.1 | ||||
NM_145032.3 | Intron | NP_659469.3 | ||||
XM_005250205.3 | Intron | XP_005250262.1 | ||||
XM_005250207.3 | Intron | XP_005250264.1 | ||||
XM_005250208.3 | Intron | XP_005250265.1 | ||||
XM_005250209.2 | Intron | XP_005250266.1 | ||||
XM_006715898.2 | Intron | XP_006715961.1 | ||||
XM_011515928.2 | Intron | XP_011514230.1 | ||||
XM_011515929.2 | Intron | XP_011514231.1 | ||||
XM_011515930.2 | Intron | XP_011514232.1 | ||||
XM_011515932.2 | Intron | XP_011514234.1 | ||||
XM_017011850.1 | Intron | XP_016867339.1 | ||||
XM_017011851.1 | Intron | XP_016867340.1 | ||||
XM_017011852.1 | Intron | XP_016867341.1 | ||||
XM_017011853.1 | Intron | XP_016867342.1 |
LRRC17 - leucine rich repeat containing 17 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001031692.2 | Intron | NP_001026862.1 | ||||
NM_005824.2 | Intron | NP_005815.2 | ||||
XM_005250108.1 | Intron | XP_005250165.1 |