Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCCCTTCCCCTCACTGAATAAAATC[C/T]GTAATAGCACCTGCCGCTTGAGTGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 608651 | ||||||||||||||||||||
Literature Links: |
AGAP1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
AGAP1 - ArfGAP with GTPase domain, ankyrin repeat and PH domain 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001037131.2 | Intron | NP_001032208.1 | ||||
NM_001244888.1 | Intron | NP_001231817.1 | ||||
NM_014914.4 | Intron | NP_055729.2 | ||||
XM_005246059.4 | Intron | XP_005246116.1 | ||||
XM_006712234.3 | Intron | XP_006712297.1 | ||||
XM_006712235.3 | Intron | XP_006712298.1 | ||||
XM_006712237.3 | Intron | XP_006712300.2 | ||||
XM_006712239.3 | Intron | XP_006712302.2 | ||||
XM_011510547.2 | Intron | XP_011508849.1 | ||||
XM_011510548.2 | Intron | XP_011508850.1 | ||||
XM_011510549.2 | Intron | XP_011508851.1 | ||||
XM_017003282.1 | Intron | XP_016858771.1 |
AGAP1-IT1 - AGAP1 intronic transcript 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |