Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAGATGAAGGAAACCATGGCTAGTA[C/G]CAAGAACTAGGGCAGCGGTAACTAA
Species: |
Human | |||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 610781 MIM: 603171 MIM: 604319 | |||||||||||||||||||||||||||||||||||||||||
Literature Links: |
GMPR2 PubMed Links | |||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | ||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | ||||||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | ||||||
EUR
|
||||||||
AMR
|
GMPR2 - guanosine monophosphate reductase 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001002000.2 | Intron | NP_001002000.1 | ||||
NM_001002001.2 | Intron | NP_001002001.1 | ||||
NM_001002002.2 | Intron | NP_001002002.1 | ||||
NM_001283021.1 | Intron | NP_001269950.1 | ||||
NM_001283022.1 | Intron | NP_001269951.1 | ||||
NM_001283023.1 | Intron | NP_001269952.1 | ||||
NM_016576.4 | Intron | NP_057660.2 | ||||
XM_005267740.3 | Intron | XP_005267797.1 | ||||
XM_005267741.3 | Intron | XP_005267798.1 | ||||
XM_005267742.3 | Intron | XP_005267799.1 | ||||
XM_006720165.2 | Intron | XP_006720228.1 | ||||
XM_017021356.1 | Intron | XP_016876845.1 | ||||
XM_017021357.1 | Intron | XP_016876846.1 | ||||
XM_017021358.1 | Intron | XP_016876847.1 | ||||
XM_017021359.1 | Intron | XP_016876848.1 | ||||
XM_017021360.1 | Intron | XP_016876849.1 |
NEDD8 - neural precursor cell expressed, developmentally down-regulated 8 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006156.2 | Intron | NP_006147.1 |
NEDD8-MDP1 - NEDD8-MDP1 readthrough | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TINF2 - TERF1 interacting nuclear factor 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Set Membership: |
HapMap |