Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGGGGTTTGGGTTAGGTGATTTCCA[C/G]CAGCCCTATCGATTCAACAGTATTT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603666 | ||||||||||||||||||||
Literature Links: |
LOC107985410 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LOC107985410 - uncharacterized LOC107985410 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
STX16 - syntaxin 16 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001001433.2 | Intron | NP_001001433.1 | ||||
NM_001134772.2 | Intron | NP_001128244.1 | ||||
NM_001134773.2 | Intron | NP_001128245.1 | ||||
NM_001204868.1 | Intron | NP_001191797.1 | ||||
NM_003763.5 | Intron | NP_003754.2 |
STX16-NPEPL1 - STX16-NPEPL1 readthrough (NMD candidate) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |