Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTTAAAATAGTGTCAGCACTGTGAC[C/T]GACTCATAGCAAGTATGGGTATCTA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 616653 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
LOC101927365 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
LOC101927365 - uncharacterized LOC101927365 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PNISR - PNN interacting serine and arginine rich protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TSTD3 - thiosulfate sulfurtransferase (rhodanese)-like domain containing 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001195131.1 | 3814 | Intron | NP_001182060.1 | |||
XM_017010141.1 | 3814 | Intron | XP_016865630.1 |
USP45 - ubiquitin specific peptidase 45 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001080481.1 | 3814 | UTR 3 | NP_001073950.1 | |||
XM_005267169.3 | 3814 | UTR 3 | XP_005267226.1 | |||
XM_005267170.4 | 3814 | UTR 3 | XP_005267227.1 | |||
XM_005267172.3 | 3814 | UTR 3 | XP_005267229.1 | |||
XM_005267175.3 | 3814 | Intron | XP_005267232.1 | |||
XM_011536200.2 | 3814 | UTR 3 | XP_011534502.1 | |||
XM_017011381.1 | 3814 | UTR 3 | XP_016866870.1 | |||
XM_017011382.1 | 3814 | UTR 3 | XP_016866871.1 | |||
XM_017011383.1 | 3814 | UTR 3 | XP_016866872.1 | |||
XM_017011384.1 | 3814 | UTR 3 | XP_016866873.1 | |||
XM_017011385.1 | 3814 | Intron | XP_016866874.1 | |||
XM_017011386.1 | 3814 | Intron | XP_016866875.1 |