Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTACCAGTTCCTGAAAAAGTGGTTC[A/G]TTAAGGGGGCTAGTCTTTTGAGACA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 153440 MIM: 601022 | ||||||||||||||||||||
Literature Links: |
LOC100287329 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LOC100287329 - uncharacterized LOC100287329 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LTA - lymphotoxin alpha | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000595.3 | 714 | Intron | NP_000586.2 | |||
NM_001159740.2 | 714 | Intron | NP_001153212.1 | |||
XM_011514615.2 | 714 | UTR 5 | XP_011512917.1 | |||
XM_011514616.2 | 714 | Intron | XP_011512918.1 | |||
XM_011514617.2 | 714 | Intron | XP_011512919.1 | |||
XM_011514618.1 | 714 | Intron | XP_011512920.1 |
NFKBIL1 - NFKB inhibitor like 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |