Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTTGCCTTGGAAAAAACCTCCGAGG[C/T]CCAGCTTGCTGCCTCGTGTGGCTCT
Species: |
Human | |||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 610701 | |||||||||||||||||||||||||||||||||||||||||
Literature Links: |
C10orf82 PubMed Links | |||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | ||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | ||||||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | ||||||
EUR
|
||||||||
AMR
|
C10orf82 - chromosome 10 open reading frame 82 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_144661.2 | 1185 | Intron | NP_653262.1 | |||
XM_011539340.2 | 1185 | Missense Mutation | ACC,GCC | T,A 250 | XP_011537642.1 | |
XM_011539341.1 | 1185 | Missense Mutation | ACC,GCC | T,A 227 | XP_011537643.1 | |
XM_011539342.2 | 1185 | Missense Mutation | ACC,GCC | T,A 227 | XP_011537644.1 | |
XM_011539343.2 | 1185 | Missense Mutation | ACC,GCC | T,A 250 | XP_011537645.1 | |
XM_011539344.2 | 1185 | Intron | XP_011537646.1 | |||
XM_011539345.2 | 1185 | Intron | XP_011537647.1 | |||
XM_011539346.2 | 1185 | Intron | XP_011537648.1 | |||
XM_011539347.2 | 1185 | Intron | XP_011537649.1 | |||
XM_017015753.1 | 1185 | Intron | XP_016871242.1 | |||
XM_017015754.1 | 1185 | Intron | XP_016871243.1 | |||
XM_017015755.1 | 1185 | UTR 3 | XP_016871244.1 |
HSPA12A - heat shock protein family A (Hsp70) member 12A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC105378499 - uncharacterized LOC105378499 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |