Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGATAACATTCTTTTTGCTTTATGT[A/G]TCTTCTATAATGTTAACATTTTTGT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 615012 MIM: 615013 MIM: 615044 MIM: 615045 MIM: 602833 | ||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
HIST1H2AG PubMed Links | ||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU)
|
||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | ||||||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | ||||||
EUR
|
||||||||
AMR
|
HIST1H2AG - histone cluster 1, H2ag | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HIST1H2AH - histone cluster 1, H2ah | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HIST1H2BJ - histone cluster 1, H2bj | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HIST1H2BK - histone cluster 1, H2bk | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001312653.1 | Intron | NP_001299582.1 | ||||
NM_080593.2 | Intron | NP_542160.1 |
HIST1H4I - histone cluster 1, H4i | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_003495.2 | Intron | NP_003486.1 |
MIR3143 - microRNA 3143 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Set Membership: |
HapMap |