Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTGCAAAACTTACTGTGGAGACGTG[C/T]CCCAGACTGGTCTCAGACCAGAGTT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 615064 MIM: 600013 | ||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
MIR6764 PubMed Links | ||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU)
|
||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | ||||||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | ||||||
EUR
|
||||||||
AMR
|
MIR6764 - microRNA 6764 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SLC25A29 - solute carrier family 25 member 29 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001039355.2 | Intron | NP_001034444.1 | ||||
NM_001291813.1 | Intron | NP_001278742.1 | ||||
NM_001291814.1 | Intron | NP_001278743.1 | ||||
NM_152333.3 | Intron | NP_689546.1 | ||||
XM_006720038.1 | Intron | XP_006720101.1 | ||||
XM_006720039.3 | Intron | XP_006720102.1 | ||||
XM_011536443.1 | Intron | XP_011534745.1 | ||||
XM_011536444.1 | Intron | XP_011534746.1 | ||||
XM_011536446.1 | Intron | XP_011534748.1 | ||||
XM_011536447.1 | Intron | XP_011534749.1 | ||||
XM_011536448.1 | Intron | XP_011534750.1 | ||||
XM_011536449.2 | Intron | XP_011534751.1 | ||||
XM_017020979.1 | Intron | XP_016876468.1 | ||||
XM_017020980.1 | Intron | XP_016876469.1 | ||||
XM_017020981.1 | Intron | XP_016876470.1 | ||||
XM_017020982.1 | Intron | XP_016876471.1 | ||||
XM_017020983.1 | Intron | XP_016876472.1 | ||||
XM_017020984.1 | Intron | XP_016876473.1 | ||||
XM_017020985.1 | Intron | XP_016876474.1 | ||||
XM_017020986.1 | Intron | XP_016876475.1 | ||||
XM_017020987.1 | Intron | XP_016876476.1 | ||||
XM_017020988.1 | Intron | XP_016876477.1 |
YY1 - YY1 transcription factor | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Set Membership: |
HapMap |