Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTATTTTTTAAAAAATCATCTTCTA[G/T]TTTTTTGTTATTTAGACATAAGATT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
44 submissions
|
||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 605210 MIM: 606271 | ||||||||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
DISC1 PubMed Links | ||||||||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU)
|
||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | JPT (Japanese)
|
||||||
AFR
|
Japanese - Not Available | CHB (Han Chinese)
|
||||||
EUR
|
||||||||
AMR
|
DISC1 - disrupted in schizophrenia 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001012957.1 | Intron | NP_001012975.1 | ||||
NM_001012958.1 | Intron | NP_001012976.1 | ||||
NM_001012959.1 | Intron | NP_001012977.1 | ||||
NM_001164537.1 | Intron | NP_001158009.1 | ||||
NM_001164538.1 | Intron | NP_001158010.1 | ||||
NM_001164539.1 | Intron | NP_001158011.1 | ||||
NM_001164540.1 | Intron | NP_001158012.1 | ||||
NM_001164541.1 | Intron | NP_001158013.1 | ||||
NM_001164542.1 | Intron | NP_001158014.1 | ||||
NM_001164544.1 | Intron | NP_001158016.1 | ||||
NM_001164545.1 | Intron | NP_001158017.1 | ||||
NM_001164546.1 | Intron | NP_001158018.1 | ||||
NM_001164547.1 | Intron | NP_001158019.1 | ||||
NM_001164548.1 | Intron | NP_001158020.1 | ||||
NM_001164549.1 | Intron | NP_001158021.1 | ||||
NM_001164550.1 | Intron | NP_001158022.1 | ||||
NM_001164551.1 | Intron | NP_001158023.1 | ||||
NM_001164552.1 | Intron | NP_001158024.1 | ||||
NM_001164553.1 | Intron | NP_001158025.1 | ||||
NM_001164554.1 | Intron | NP_001158026.1 | ||||
NM_001164555.1 | Intron | NP_001158027.1 | ||||
NM_001164556.1 | Intron | NP_001158028.1 | ||||
NM_018662.2 | Intron | NP_061132.2 |
DISC2 - disrupted in schizophrenia 2 (non-protein coding) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TSNAX-DISC1 - TSNAX-DISC1 readthrough (NMD candidate) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |