Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGCAGGTACTGGCAGCTGGGAGTCA[A/G]ATTACCTTTGTACAATGAAGTTGTA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||
Literature Links: |
BANF2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
BANF2 - barrier to autointegration factor 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001014977.3 | Intron | NP_001014977.2 | ||||
NM_001159495.1 | Intron | NP_001152967.1 | ||||
NM_178477.4 | Intron | NP_848572.3 | ||||
XM_005260668.3 | Intron | XP_005260725.1 | ||||
XM_011529170.1 | Intron | XP_011527472.1 | ||||
XM_011529171.2 | Intron | XP_011527473.1 |
LOC105372547 - uncharacterized LOC105372547 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |