Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGCCGCTCAGCGCCTCATCGCCGTA[A/G]AAGGGTGTTTCCATCCTCCGCCTCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 165162 | ||||||||||||||||||||
Literature Links: |
JUND PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
JUND - JunD proto-oncogene, AP-1 transcription factor subunit | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001286968.1 | 187 | UTR 5 | NP_001273897.1 | |||
NM_005354.5 | 187 | Silent Mutation | TTC,TTT | F,F 5 | NP_005345.3 |
KIAA1683 - KIAA1683 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR3188 - microRNA 3188 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |