Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGTTGGTTCAGGAGCTCACTTCCCT[A/C]TACAGACACACTGTCACTGCTAGGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
1 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 609473 MIM: 600087 | ||||||||||||||||||||
Literature Links: |
CGN PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CGN - cingulin | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR554 - microRNA 554 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TUFT1 - tuftelin 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001126337.1 | Intron | NP_001119809.1 | ||||
NM_001301317.1 | Intron | NP_001288246.1 | ||||
NM_020127.2 | Intron | NP_064512.1 | ||||
XM_011509961.2 | Intron | XP_011508263.1 | ||||
XM_017002223.1 | Intron | XP_016857712.1 | ||||
XM_017002224.1 | Intron | XP_016857713.1 |