Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GAGCCATAATAAATAACTTGGACAG[C/T]TGCTCCTTGACTTACAAATGGAGTT
Species: |
Human | ||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||
Phenotype: |
MIM: 607804 MIM: 607805 | ||||||||||||||||||||||||||
Literature Links: |
CNNM3 PubMed Links | ||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU)
|
|||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese)
|
|||
EUR - Not Available | |||||
AMR - Not Available |
CNNM3 - cyclin and CBS domain divalent metal cation transport mediator 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_017623.4 | Intron | NP_060093.3 | ||||
NM_199078.2 | Intron | NP_951060.1 | ||||
XM_011510957.2 | Intron | XP_011509259.1 | ||||
XM_017003800.1 | Intron | XP_016859289.1 |
CNNM4 - cyclin and CBS domain divalent metal cation transport mediator 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |