Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTGCCATCTTTCCTGGATCTTGTAG[C/T]GGGTGCACACGCGTGCACTGGGACC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
45 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 610770 MIM: 615921 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
KLHL17 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
KLHL17 - kelch like family member 17 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_198317.2 | 3041 | UTR 3 | NP_938073.1 | |||
XM_006710600.3 | 3041 | UTR 3 | XP_006710663.1 | |||
XM_006710601.3 | 3041 | Intron | XP_006710664.1 |
NOC2L - NOC2 like nucleolar associated transcriptional repressor | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PERM1 - PPARGC1 and ESRR induced regulator, muscle 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PLEKHN1 - pleckstrin homology domain containing N1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001160184.1 | 3041 | Intron | NP_001153656.1 | |||
NM_032129.2 | 3041 | Intron | NP_115505.2 | |||
XM_006710944.3 | 3041 | Intron | XP_006711007.2 | |||
XM_011542248.2 | 3041 | Intron | XP_011540550.2 | |||
XM_017002474.1 | 3041 | Intron | XP_016857963.1 | |||
XM_017002475.1 | 3041 | Intron | XP_016857964.1 | |||
XM_017002476.1 | 3041 | Intron | XP_016857965.1 | |||
XM_017002477.1 | 3041 | Intron | XP_016857966.1 | |||
XM_017002478.1 | 3041 | Intron | XP_016857967.1 | |||
XM_017002479.1 | 3041 | Intron | XP_016857968.1 |