Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCTTTCCTTAACCCTACACCCTTTA[G/T]CTGGATGCTGTCAGAGGCGATGGAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||
Literature Links: |
WDFY3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
WDFY3 - WD repeat and FYVE domain containing 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_014991.4 | Intron | NP_055806.2 | ||||
XM_005262858.4 | Intron | XP_005262915.1 | ||||
XM_011531757.2 | Intron | XP_011530059.1 | ||||
XM_011531759.2 | Intron | XP_011530061.1 | ||||
XM_011531760.2 | Intron | XP_011530062.1 | ||||
XM_011531761.2 | Intron | XP_011530063.1 | ||||
XM_011531762.2 | Intron | XP_011530064.1 | ||||
XM_011531763.2 | Intron | XP_011530065.1 | ||||
XM_011531764.2 | Intron | XP_011530066.1 | ||||
XM_011531765.2 | Intron | XP_011530067.1 | ||||
XM_011531766.2 | Intron | XP_011530068.1 | ||||
XM_011531767.2 | Intron | XP_011530069.1 | ||||
XM_017007906.1 | Intron | XP_016863395.1 | ||||
XM_017007907.1 | Intron | XP_016863396.1 | ||||
XM_017007908.1 | Intron | XP_016863397.1 | ||||
XM_017007909.1 | Intron | XP_016863398.1 |
WDFY3-AS2 - WDFY3 antisense RNA 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |