Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACATAGTAGTAGCAAAGGTATGGTG[C/T]TCATGGAACTCTAAAGGCAGGAACA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 601625 MIM: 606372 MIM: 601021 | ||||||||||||||||||||
Literature Links: |
ART1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ART1 - ADP-ribosyltransferase 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CHRNA10 - cholinergic receptor nicotinic alpha 10 subunit | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NUP98 - nucleoporin 98 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_005387.6 | 6237 | Intron | NP_005378.4 | |||
NM_016320.4 | 6237 | UTR 3 | NP_057404.2 | |||
NM_139131.4 | 6237 | Intron | NP_624357.1 | |||
NM_139132.3 | 6237 | UTR 3 | NP_624358.2 |