Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTTTCGAGGCTGCGGTGAGTGTATG[C/T]ACCCTCCAGGGGACAACTGAGAAAT
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 609799 MIM: 602464 | |||||||||||||||||||||||
Literature Links: |
NEK8 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese)
|
|||
EUR - Not Available | |||||
AMR - Not Available |
NEK8 - NIMA related kinase 8 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_178170.2 | Intron | NP_835464.1 | ||||
XM_011524638.2 | Intron | XP_011522940.1 | ||||
XM_011524640.2 | Intron | XP_011522942.1 | ||||
XM_017024499.1 | Intron | XP_016879988.1 | ||||
XM_017024500.1 | Intron | XP_016879989.1 | ||||
XM_017024501.1 | Intron | XP_016879990.1 |
TLCD1 - TLC domain containing 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TRAF4 - TNF receptor associated factor 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |