Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACTACGTCTGTAAAGAGTCCAAACT[A/C]TCTCTACGTCAGTGCCTTCATATTT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 616998 MIM: 616874 | ||||||||||||||||||||
Literature Links: |
LLPH PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LLPH - LLP homolog, long-term synaptic facilitation | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_032338.3 | Intron | NP_115714.1 |
LLPH-AS1 - LLPH antisense RNA 1 (head to head) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMBIM4 - transmembrane BAX inhibitor motif containing 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |