Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTCCTCACCTGGCCCTGACTCACTT[C/T]TAGGTGAGGAATAAGTAAGAAATAC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 614730 MIM: 608292 | ||||||||||||||||||||
Literature Links: |
FAM214B PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FAM214B - family with sequence similarity 214 member B | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001317991.1 | Intron | NP_001304920.1 | ||||
NM_025182.3 | Intron | NP_079458.2 | ||||
XM_005251588.1 | Intron | XP_005251645.1 | ||||
XM_005251590.1 | Intron | XP_005251647.1 | ||||
XM_005251591.1 | Intron | XP_005251648.1 | ||||
XM_005251592.1 | Intron | XP_005251649.1 | ||||
XM_005251593.1 | Intron | XP_005251650.1 | ||||
XM_005251594.1 | Intron | XP_005251651.1 | ||||
XM_005251596.4 | Intron | XP_005251653.1 | ||||
XM_005251597.4 | Intron | XP_005251654.1 | ||||
XM_005251598.4 | Intron | XP_005251655.1 | ||||
XM_011518037.1 | Intron | XP_011516339.1 | ||||
XM_011518039.1 | Intron | XP_011516341.1 | ||||
XM_011518040.1 | Intron | XP_011516342.1 | ||||
XM_011518043.1 | Intron | XP_011516345.1 | ||||
XM_011518044.1 | Intron | XP_011516346.1 | ||||
XM_017015169.1 | Intron | XP_016870658.1 | ||||
XM_017015170.1 | Intron | XP_016870659.1 |
PIGO - phosphatidylinositol glycan anchor biosynthesis class O | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
STOML2 - stomatin like 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |