Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGATCTGCAACCCGCACCTTAATGG[G/T]CTCAGCACTCAGCCCCTGGTCTCCG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604719 MIM: 191110 | ||||||||||||||||||||
Literature Links: |
GLB1L PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
GLB1L - galactosidase beta 1 like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
STK16 - serine/threonine kinase 16 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TUBA4A - tubulin alpha 4a | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001278552.1 | Intron | NP_001265481.1 | ||||
NM_006000.2 | Intron | NP_005991.1 | ||||
XM_017004824.1 | Intron | XP_016860313.1 |
TUBA4B - tubulin alpha 4b | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |