Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGGGAGCCCGGGGCCTGCTCCTCAG[C/G]CCCCCCCCGCCGCAGGATGGGAAGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 616184 MIM: 601545 | ||||||||||||||||||||
Literature Links: |
CLUH PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CLUH - clustered mitochondria homolog | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_015229.3 | Intron | NP_056044.3 | ||||
XM_011523768.2 | Intron | XP_011522070.1 |
MIR6776 - microRNA 6776 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PAFAH1B1 - platelet activating factor acetylhydrolase 1b regulatory subunit 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |