Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AAAAAAAAAAAAATTAAATTTTTTT[C/T]CTTTTCTAGCCATCTCTATGGTCAC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603178 | ||||||||||||||||||||
Literature Links: |
ALDH6A1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ALDH6A1 - aldehyde dehydrogenase 6 family member A1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
BBOF1 - basal body orientation factor 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LIN52 - lin-52 DREAM MuvB core complex component | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001024674.2 | Intron | NP_001019845.1 | ||||
XM_011537320.2 | Intron | XP_011535622.1 | ||||
XM_011537321.2 | Intron | XP_011535623.1 | ||||
XM_011537322.2 | Intron | XP_011535624.2 | ||||
XM_017021763.1 | Intron | XP_016877252.1 | ||||
XM_017021764.1 | Intron | XP_016877253.1 |