Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACTTTGCACTTCTGAAATAGCAAGT[C/T]TTAAAGCCCAGTGGCCCTTTAAAAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||
Literature Links: |
C10orf90 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C10orf90 - chromosome 10 open reading frame 90 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001004298.2 | Intron | NP_001004298.2 | ||||
XM_005269491.1 | Intron | XP_005269548.1 | ||||
XM_005269492.2 | Intron | XP_005269549.1 | ||||
XM_011539216.1 | Intron | XP_011537518.1 | ||||
XM_011539217.2 | Intron | XP_011537519.1 | ||||
XM_011539220.2 | Intron | XP_011537522.1 | ||||
XM_011539222.2 | Intron | XP_011537524.1 | ||||
XM_011539223.2 | Intron | XP_011537525.1 | ||||
XM_011539224.2 | Intron | XP_011537526.1 | ||||
XM_011539226.1 | Intron | XP_011537528.1 | ||||
XM_011539227.2 | Intron | XP_011537529.1 | ||||
XM_011539230.2 | Intron | XP_011537532.1 | ||||
XM_011539231.1 | Intron | XP_011537533.1 | ||||
XM_011539232.1 | Intron | XP_011537534.1 | ||||
XM_011539233.1 | Intron | XP_011537535.1 | ||||
XM_017015634.1 | Intron | XP_016871123.1 | ||||
XM_017015635.1 | Intron | XP_016871124.1 |
LINC00601 - long intergenic non-protein coding RNA 601 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC728158 - hCG2044975 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |