Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTCAGGTTCACTACGGGATGGCTTA[G/T]GCCAGGGAACAGCATGTGCGAAGTT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 613297 MIM: 611756 | ||||||||||||||||||||
Literature Links: |
MARCH6 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MARCH6 - membrane associated ring-CH-type finger 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ROPN1L - rhophilin associated tail protein 1 like | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001201466.1 | Intron | NP_001188395.1 | ||||
NM_031916.4 | Intron | NP_114122.2 | ||||
XM_006714503.2 | Intron | XP_006714566.1 | ||||
XM_006714504.2 | Intron | XP_006714567.1 | ||||
XM_017009946.1 | Intron | XP_016865435.1 | ||||
XM_017009947.1 | Intron | XP_016865436.1 |
ROPN1L-AS1 - ROPN1L antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |