Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTCAATGTGTGCCTCAAAGGGTGCC[A/G]TGGACAAGAACGAGAAGTGCTTGTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 614144 MIM: 607263 | ||||||||||||||||||||
Literature Links: |
B9D1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
B9D1 - B9 domain containing 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001243473.2 | Intron | NP_001230402.1 | ||||
NM_001243475.2 | Intron | NP_001230404.1 | ||||
NM_001321214.1 | Intron | NP_001308143.1 | ||||
NM_001321215.1 | Intron | NP_001308144.1 | ||||
NM_001321216.1 | Intron | NP_001308145.1 | ||||
NM_001321217.1 | Intron | NP_001308146.1 | ||||
NM_001321218.1 | Intron | NP_001308147.1 | ||||
NM_001321219.1 | Intron | NP_001308148.1 | ||||
NM_015681.4 | Intron | NP_056496.1 | ||||
XM_005256607.2 | Intron | XP_005256664.1 | ||||
XM_005256610.1 | Intron | XP_005256667.1 | ||||
XM_017024452.1 | Intron | XP_016879941.1 |
EPN2 - epsin 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR1180 - microRNA 1180 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |