Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGTGAGCTGAACACTGAAAGATAGA[C/T]GAGGTGTTAATTCAAGAAGATATGA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
32 submissions
|
||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 607245 | ||||||||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
AP4B1 PubMed Links | ||||||||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU)
|
||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | JPT (Japanese)
|
||||||
AFR
|
Japanese - Not Available | CHB (Han Chinese)
|
||||||
EUR
|
||||||||
AMR
|
AP4B1 - adaptor related protein complex 4 beta 1 subunit | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001253852.2 | 2549 | UTR 3 | NP_001240781.1 | |||
NM_001253853.2 | 2549 | UTR 3 | NP_001240782.1 | |||
NM_001308312.1 | 2549 | UTR 3 | NP_001295241.1 | |||
NM_006594.4 | 2549 | UTR 3 | NP_006585.2 | |||
XM_011540523.2 | 2549 | Intron | XP_011538825.1 | |||
XM_011540524.2 | 2549 | Intron | XP_011538826.1 | |||
XM_011540525.2 | 2549 | Intron | XP_011538827.1 | |||
XM_011540528.2 | 2549 | Intron | XP_011538830.1 | |||
XM_017000088.1 | 2549 | Intron | XP_016855577.1 | |||
XM_017000089.1 | 2549 | Intron | XP_016855578.1 | |||
XM_017000090.1 | 2549 | Intron | XP_016855579.1 | |||
XM_017000091.1 | 2549 | Intron | XP_016855580.1 | |||
XM_017000092.1 | 2549 | Intron | XP_016855581.1 | |||
XM_017000093.1 | 2549 | Intron | XP_016855582.1 |
AP4B1-AS1 - AP4B1 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
BCL2L15 - BCL2 like 15 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Set Membership: |
HapMap |