Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCTGCACTCTTGGAAAAGGATGTAT[C/T]TGAAACACCTTCTGATGGATGAAAG
Species: |
Human | |||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||||||||
Phenotype: |
||||||||||||||||||||||||||||||
Literature Links: |
EQTN PubMed Links | |||||||||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU)
|
|||
EAS - Not Available | African American - Not Available | YRI (Yoruba)
|
|||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese)
|
|||
EUR - Not Available | |||||
AMR - Not Available |
EQTN - equatorin | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LINC00032 - long intergenic non-protein coding RNA 32 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |