Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AAAAAAAAGTCTTGGTTCCAAACCA[G/T]GATATATGAGTGGGATCCCTGCTTT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||
Literature Links: |
LOC100499484 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LOC100499484 - SUGT1-1300002K09Rik pseudogene | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC100499484-C9ORF174 - LOC100499484-C9orf174 readthrough | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |