Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGACAGAGTCTTGCCCTATTGCCCA[G/T]GCTGGAGTGCAGTGGTGAAAACAAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||
Literature Links: |
PTGES3L PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
PTGES3L - prostaglandin E synthase 3 like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PTGES3L-AARSD1 - PTGES3L-AARSD1 readthrough | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RUNDC1 - RUN domain containing 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001321381.1 | Intron | NP_001308310.1 | ||||
NM_173079.3 | Intron | NP_775102.2 | ||||
XM_005257078.3 | Intron | XP_005257135.1 | ||||
XM_005257080.3 | Intron | XP_005257137.1 |