Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TAACAAGAGATGAAAACAAAGCTAA[A/C]CAAGGATAAGCTATTGGTTTTATTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 164015 | ||||||||||||||||||||
Literature Links: |
MATR3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MATR3 - matrin 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001194954.1 | Intron | NP_001181883.1 | ||||
NM_001194955.1 | Intron | NP_001181884.1 | ||||
NM_001194956.1 | Intron | NP_001181885.1 | ||||
NM_001282278.1 | Intron | NP_001269207.1 | ||||
NM_018834.5 | Intron | NP_061322.2 | ||||
NM_199189.2 | Intron | NP_954659.1 |
SNHG4 - small nucleolar RNA host gene 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORA74A - small nucleolar RNA, H/ACA box 74A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |