Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGGGAGACCCCAGCCATGTTCCTGC[A/C]CCACTCCTCATTTCTAAGAGATGGG
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 613169 | |||||||||||||||||||||||
Literature Links: |
C3orf84 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
C3orf84 - chromosome 3 open reading frame 84 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CCDC71 - coiled-coil domain containing 71 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
KLHDC8B - kelch domain containing 8B | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_173546.2 | Intron | NP_775817.1 | ||||
XM_005264938.2 | Intron | XP_005264995.1 | ||||
XM_005264940.4 | Intron | XP_005264997.1 | ||||
XM_006713015.2 | Intron | XP_006713078.1 | ||||
XM_006713016.2 | Intron | XP_006713079.1 |