Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGCGCCAGCAGCAGCGACTAGCGGG[C/G]AACGGCGCGCAGGAAGGCAGGCAGA
Species: |
Human | |||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
33 submissions
|
|||||||||||||||||||||||||||||||||||||||||
Phenotype: |
||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
SNHG12 PubMed Links | |||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | ||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | ||||||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | ||||||
EUR
|
||||||||
AMR
|
SNHG12 - small nucleolar RNA host gene 12 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORA16A - small nucleolar RNA, H/ACA box 16A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORA44 - small nucleolar RNA, H/ACA box 44 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORA61 - small nucleolar RNA, H/ACA box 61 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD99 - small nucleolar RNA, C/D box 99 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TRNAU1AP - tRNA selenocysteine 1 associated protein 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |