Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTAATACTATATATTAGATGAATTG[A/T]ATTTGTACAACTGACAATATACAAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 601554 MIM: 613209 | ||||||||||||||||||||
Literature Links: |
DYNLT1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
DYNLT1 - dynein light chain Tctex-type 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001291602.1 | Intron | NP_001278531.1 | ||||
NM_001291603.1 | Intron | NP_001278532.1 | ||||
NM_006519.3 | Intron | NP_006510.1 |
SYTL3 - synaptotagmin like 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMEM181 - transmembrane protein 181 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |