Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTAAGACAGTCTCACTCTGTACCTA[A/G]GCTGGAGTGCAGTGGCACGATCTCG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 615049 | ||||||||||||||||||||
Literature Links: |
WAC PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
WAC - WW domain containing adaptor with coiled-coil | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_016628.4 | Intron | NP_057712.2 | ||||
NM_100264.2 | Intron | NP_567822.1 | ||||
NM_100486.3 | Intron | NP_567823.1 | ||||
XM_011519491.2 | Intron | XP_011517793.1 | ||||
XM_017016315.1 | Intron | XP_016871804.1 | ||||
XM_017016316.1 | Intron | XP_016871805.1 | ||||
XM_017016317.1 | Intron | XP_016871806.1 | ||||
XM_017016318.1 | Intron | XP_016871807.1 |
WAC-AS1 - WAC antisense RNA 1 (head to head) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |