Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TAGGGTTCTGGAATGCATAACTAAA[G/T]GGATGATGACACTATTCACTGAGAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 611119 | ||||||||||||||||||||
Literature Links: |
KLHL7 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
KLHL7 - kelch like family member 7 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001031710.2 | Intron | NP_001026880.2 | ||||
NM_001172428.1 | Intron | NP_001165899.1 | ||||
NM_018846.4 | Intron | NP_061334.4 | ||||
XM_006715753.2 | Intron | XP_006715816.1 | ||||
XM_006715754.2 | Intron | XP_006715817.1 | ||||
XM_006715755.2 | Intron | XP_006715818.1 | ||||
XM_006715756.2 | Intron | XP_006715819.1 | ||||
XM_006715757.3 | Intron | XP_006715820.1 | ||||
XM_017012439.1 | Intron | XP_016867928.1 | ||||
XM_017012440.1 | Intron | XP_016867929.1 | ||||
XM_017012441.1 | Intron | XP_016867930.1 |
KLHL7-AS1 - KLHL7 antisense RNA 1 (head to head) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |