Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCGCTGCATTCTCGGCCGGGCTCTA[A/G]GCGCCATGGCTCCCCGCGGGAGGAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607914 MIM: 616715 | ||||||||||||||||||||
Literature Links: |
BTBD18 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
BTBD18 - BTB domain containing 18 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
C11orf31 - chromosome 11 open reading frame 31 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001321335.1 | 341 | UTR 5 | NP_001308264.1 | |||
NM_170746.3 | 341 | UTR 5 | NP_734467.1 |
TMX2 - thioredoxin related transmembrane protein 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001144012.2 | 341 | Intron | NP_001137484.1 | |||
NM_015959.3 | 341 | Intron | NP_057043.1 |
TMX2-CTNND1 - TMX2-CTNND1 readthrough (NMD candidate) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |