Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGGAGTTGGGCAGGCTCTGGCCTTC[C/T]TCTTGAGCAGAAGAGTGCCAGACAA
Species: |
Human | ||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 607914 MIM: 616715 | ||||||||||||||||||||||||||||||||
Literature Links: |
BTBD18 PubMed Links | ||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU)
|
|||
EAS - Not Available | African American - Not Available | YRI (Yoruba)
|
|||
SAS - Not Available | Chinese - Not Available | JPT (Japanese)
|
|||
AFR - Not Available | Japanese - Not Available | CHB (Han Chinese)
|
|||
EUR - Not Available | |||||
AMR - Not Available |
BTBD18 - BTB domain containing 18 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001145101.1 | 2174 | Missense Mutation | AAG,AGG | K,R 209 | NP_001138573.1 | |
XM_011545212.2 | 2174 | Missense Mutation | AAG,AGG | K,R 209 | XP_011543514.1 | |
XM_017018127.1 | 2174 | Missense Mutation | AAG,AGG | K,R 209 | XP_016873616.1 | |
XM_017018128.1 | 2174 | Missense Mutation | AAG,AGG | K,R 209 | XP_016873617.1 |
C11orf31 - chromosome 11 open reading frame 31 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMX2 - thioredoxin related transmembrane protein 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMX2-CTNND1 - TMX2-CTNND1 readthrough (NMD candidate) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |