Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTGGCCCCAGAATTAGATGGAGCGT[C/G]CATCCTGGCACGTTCTGGTCAGTGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 610108 | ||||||||||||||||||||
Literature Links: |
ANO1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ANO1 - anoctamin 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_018043.5 | Intron | NP_060513.5 | ||||
XM_006718602.2 | Intron | XP_006718665.1 | ||||
XM_006718604.2 | Intron | XP_006718667.1 | ||||
XM_006718605.2 | Intron | XP_006718668.1 | ||||
XM_011545121.2 | Intron | XP_011543423.1 | ||||
XM_011545123.2 | Intron | XP_011543425.1 | ||||
XM_011545124.2 | Intron | XP_011543426.1 | ||||
XM_011545125.2 | Intron | XP_011543427.1 | ||||
XM_011545126.2 | Intron | XP_011543428.1 | ||||
XM_011545127.2 | Intron | XP_011543429.1 | ||||
XM_011545128.2 | Intron | XP_011543430.1 | ||||
XM_011545129.2 | Intron | XP_011543431.1 | ||||
XM_011545131.2 | Intron | XP_011543433.1 | ||||
XM_017017956.1 | Intron | XP_016873445.1 | ||||
XM_017017957.1 | Intron | XP_016873446.1 |
ANO1-AS2 - ANO1 antisense RNA 2 (head to head) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |