Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCAGCTCAACCCCTGCCCCTCCCCC[A/C]AAAAAAAGGGCTAGGCTCTGCACAC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 611805 MIM: 603715 | ||||||||||||||||||||
Literature Links: |
ELOVL5 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ELOVL5 - ELOVL fatty acid elongase 5 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001242828.1 | Intron | NP_001229757.1 | ||||
NM_001242830.1 | Intron | NP_001229759.1 | ||||
NM_001242831.1 | Intron | NP_001229760.1 | ||||
NM_001301856.1 | Intron | NP_001288785.1 | ||||
NM_021814.4 | Intron | NP_068586.1 |
GCM1 - glial cells missing homolog 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR5685 - microRNA 5685 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |