Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTGTGTGTATTGAAATTGAGCTTTC[A/G]ATGTTAAATCTTCCAAGAGTTGTAT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 602324 MIM: 612189 MIM: 610328 | ||||||||||||||||||||
Literature Links: |
HNRNPH3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
PBLD - phenazine biosynthesis like protein domain containing | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001033083.1 | Intron | NP_001028255.1 | ||||
NM_022129.3 | Intron | NP_071412.2 | ||||
XM_005270028.3 | Intron | XP_005270085.1 | ||||
XM_011540060.2 | Intron | XP_011538362.1 | ||||
XM_017016513.1 | Intron | XP_016872002.1 | ||||
XM_017016514.1 | Intron | XP_016872003.1 |
RUFY2 - RUN and FYVE domain containing 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |