Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGGAAAAGGGTACTTGCTGTGTATC[A/C]TGGGTCAGTAATATTGAAAACTGTC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
1 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 606366 | ||||||||||||||||||||
Literature Links: |
DUSP5P1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
DUSP5P1 - dual specificity phosphatase 5 pseudogene 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC105373132 - uncharacterized LOC105373132 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RHOU - ras homolog family member U | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_021205.5 | Intron | NP_067028.1 |
RNA5S16 - RNA, 5S ribosomal 16 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RNA5S17 - RNA, 5S ribosomal 17 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |