Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTTCCCCCATCCCCAGGCCCCATTG[G/T]TACCAGATGGTCTCACCCCTGCCTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 609074 MIM: 603002 | ||||||||||||||||||||
Literature Links: |
FBXW9 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FBXW9 - F-box and WD repeat domain containing 9 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD135 - small nucleolar RNA, C/D box 135 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD41 - small nucleolar RNA, C/D box 41 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TNPO2 - transportin 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001136195.1 | Intron | NP_001129667.1 | ||||
NM_001136196.1 | Intron | NP_001129668.1 | ||||
NM_013433.4 | Intron | NP_038461.2 |