Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TAGTTGTACCTATTTCATGACTGTC[A/G]AGAGGATTTAAAGACTCAATTCCTG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
32 submissions
|
||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 605708 | ||||||||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
ARHGEF11 PubMed Links | ||||||||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU)
|
||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | JPT (Japanese)
|
||||||
AFR
|
Japanese - Not Available | CHB (Han Chinese)
|
||||||
EUR
|
||||||||
AMR
|
ARHGEF11 - Rho guanine nucleotide exchange factor 11 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LRRC71 - leucine rich repeat containing 71 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_144702.2 | Intron | NP_653303.2 | ||||
XM_005244926.3 | Intron | XP_005244983.1 | ||||
XM_005244927.3 | Intron | XP_005244984.1 | ||||
XM_005244928.2 | Intron | XP_005244985.1 | ||||
XM_006711185.3 | Intron | XP_006711248.1 | ||||
XM_006711186.3 | Intron | XP_006711249.1 | ||||
XM_006711187.3 | Intron | XP_006711250.1 | ||||
XM_011509239.2 | Intron | XP_011507541.1 | ||||
XM_011509240.2 | Intron | XP_011507542.1 | ||||
XM_011509241.2 | Intron | XP_011507543.1 | ||||
XM_017000459.1 | Intron | XP_016855948.1 | ||||
XM_017000460.1 | Intron | XP_016855949.1 | ||||
XM_017000461.1 | Intron | XP_016855950.1 | ||||
XM_017000462.1 | Intron | XP_016855951.1 |
MIR765 - microRNA 765 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Set Membership: |
HapMap |