Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCTTTGGGGTCCGGACTGTGGTGAA[A/G]GTGCGTTTGGGCTGCGTCACTGAAG
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 613304 MIM: 607382 MIM: 615535 | |||||||||||||||||||||||
Literature Links: |
ALKBH6 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU)
|
|||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
ALKBH6 - alkB homolog 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CLIP3 - CAP-Gly domain containing linker protein 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001199570.1 | 1850 | Silent Mutation | ACC,ACT | T,T 512 | NP_001186499.1 | |
NM_015526.2 | 1850 | Silent Mutation | ACC,ACT | T,T 512 | NP_056341.1 |
LOC101927572 - uncharacterized LOC101927572 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001290056.1 | 1850 | Silent Mutation | AAA,AAG | K,K 16 | NP_001276985.1 |
SYNE4 - spectrin repeat containing nuclear envelope family member 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Set Membership: |
HapMap |