Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGGGAGGAGGTGGGGACGGTGCTTA[A/G]GAGTGGGGCCGAGACAGGATGGGTA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 602673 MIM: 604434 MIM: 605539 | ||||||||||||||||||||
Literature Links: |
KLK10 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
KLK10 - kallikrein related peptidase 10 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
KLK11 - kallikrein related peptidase 11 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001136032.2 | Intron | NP_001129504.1 | ||||
NM_001167605.1 | Intron | NP_001161077.1 | ||||
NM_006853.2 | Intron | NP_006844.1 | ||||
NM_144947.1 | Intron | NP_659196.1 | ||||
XM_005258439.3 | Intron | XP_005258496.1 | ||||
XM_011526369.1 | Intron | XP_011524671.1 | ||||
XM_011526370.2 | Intron | XP_011524672.1 | ||||
XM_011526371.2 | Intron | XP_011524673.1 | ||||
XM_011526372.2 | Intron | XP_011524674.1 | ||||
XM_011526373.1 | Intron | XP_011524675.1 |
KLK12 - kallikrein related peptidase 12 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |