Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GAGGTGAGACGTGCCAGACTTCTTG[A/C]AGGGAGACCCAAGCTGTAGCTCCTG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 613486 MIM: 607642 MIM: 184756 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
MIR33B PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
MIR33B - microRNA 33b | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR6777 - microRNA 6777 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RAI1 - retinoic acid induced 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_030665.3 | 4552 | Intron | NP_109590.3 | |||
XM_017024025.1 | 4552 | Intron | XP_016879514.1 | |||
XM_017024026.1 | 4552 | Intron | XP_016879515.1 | |||
XM_017024027.1 | 4552 | Intron | XP_016879516.1 | |||
XM_017024028.1 | 4552 | Intron | XP_016879517.1 |
SREBF1 - sterol regulatory element binding transcription factor 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001005291.2 | 4552 | UTR 3 | NP_001005291.1 | |||
NM_001321096.2 | 4552 | Intron | NP_001308025.1 | |||
NM_004176.4 | 4552 | UTR 3 | NP_004167.3 | |||
XM_005256772.4 | 4552 | Intron | XP_005256829.1 | |||
XM_017024970.1 | 4552 | Intron | XP_016880459.1 | |||
XM_017024971.1 | 4552 | Intron | XP_016880460.1 |