Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AAAAAAAGAAAAAGAAAAACCACTC[A/T]TCAGGTTGTATGCAGGATGTAAATA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
43 submissions
|
||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 607629 MIM: 615782 | ||||||||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
APH1A PubMed Links | ||||||||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU)
|
||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | JPT (Japanese)
|
||||||
AFR
|
Japanese - Not Available | CHB (Han Chinese)
|
||||||
EUR
|
||||||||
AMR
|
APH1A - aph-1 homolog A, gamma-secretase subunit | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001077628.2 | Intron | NP_001071096.1 | ||||
NM_001243771.1 | Intron | NP_001230700.1 | ||||
NM_001243772.1 | Intron | NP_001230701.1 | ||||
NM_016022.3 | Intron | NP_057106.2 | ||||
XM_017001417.1 | Intron | XP_016856906.1 |
C1orf54 - chromosome 1 open reading frame 54 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001301039.1 | Intron | NP_001287968.1 | ||||
NM_001301040.1 | Intron | NP_001287969.1 | ||||
NM_001301041.1 | Intron | NP_001287970.1 | ||||
NM_001301042.1 | Intron | NP_001287971.1 | ||||
NM_024579.3 | Intron | NP_078855.2 | ||||
XM_011509984.2 | Intron | XP_011508286.1 |
CIART - circadian associated repressor of transcription | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Set Membership: |
HapMap |