Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CATCCTAACTAGCAATAATATGTAT[C/T]AGAATGCTACTTATTAAAAATAGTA
Species: |
Human | |||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 615810 MIM: 612823 | |||||||||||||||||||||||||||||||||||||||||
Literature Links: |
C11orf54 PubMed Links | |||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | ||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | ||||||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | ||||||
EUR
|
||||||||
AMR
|
C11orf54 - chromosome 11 open reading frame 54 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CEP295 - centrosomal protein 295 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR1304 - microRNA 1304 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORA1 - small nucleolar RNA, H/ACA box 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORA18 - small nucleolar RNA, H/ACA box 18 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORA25 - small nucleolar RNA, H/ACA box 25 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORA32 - small nucleolar RNA, H/ACA box 32 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORA40 - small nucleolar RNA, H/ACA box 40 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORA8 - small nucleolar RNA, H/ACA box 8 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD5 - small nucleolar RNA, C/D box 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD6 - small nucleolar RNA, C/D box 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TAF1D - TATA-box binding protein associated factor, RNA polymerase I subunit D | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_024116.3 | Intron | NP_077021.1 |
Set Membership: |
HapMap |